Necap2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGTTTGTCCAGGGAACAA and CTACAGGCCATAGGCCCACA, which resulted in a 522 bp deletion beginning at Chromosome 4 position 141,073,465 bp and ending after 141,073,986 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254927 and ENSMUSE00001278646 (exons 3 and 4) and 335 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 65 and early truncation 1 amino acid later. (J:188991)