Nap1l3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCCCTGAAGTCATGGTAGT and TCACAGAACCTGGTGCCCAT, which resulted in a 1549 bp deletion beginning at Chromosome X position 122,395,429 bp and ending after 122,396,977 bp (GRCm38/mm10). This mutation deletes 1549 bp of ENSMUSE00000471845 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 17 amino acids later. (J:188991)