This allele represents a pool of two possible out-of frame insertion null alleles created using an sgRNA (AGCGGGAAACTACGATAGTC) and CRISPR/Cas9 technology: a single base insertion of an A (c.294dup) (Gykl1em1Juhu) and/or a 236-base insertion (c.290_291ins236) (Gykl1em2Juhu). This allele is used where the specific allele or allele combination is not specified. (J:278636)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count