This allele represents a pool of two possible out-of frame deletion null alleles created using an sgRNA (TTGGAAGGCGTGCCAATATC) and CRISPR/Cas9 technology: a two-base deletion of reverse strand AT (c.759_760del) (Gk2em1Juhu) and/or a 14-base deletion of reverse strand CCAATATCTGGATG (c.754_767del) (Gk2em2Juhu). This allele is used where the specific allele or allele combination is not specified. (J:278636)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count