This allele from project TCPR1388 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTCGGTTAAGCCACATTCGT targeting the 5' side and GTAACTGAGCAATTAGATCC targeting the 3' side of a critical region. This resulted in a 801-bp del Chr5:76896142 to 76896942 (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count