This allele from project TCPR1387 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTGCCGCAGTGCCTATTTG targeting the 5' side and ATGCAATATATTTAGGCTAG targeting the 3' side of a critical region. This resulted in a 743-bp del Chr3:103311039-103311781; 6-bp indel Chr3:103311016-103311021delAAAAAA, likely a polymorphism independent of Cas9 activity (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count