CRISPR/Cas9 endonuclease-mediated genome editing is used to insert loxP sites flanking exon 3. A single guide RNA with a spacer sequence and Cas9 endonuclease mRNA were introduced into NOD/ShiLtJ-derived fertilized eggs by pronuclear injection along with a single-strand oligonucleotide repair template with the loxP sequence (ATAACTTCGTATAATGTATGCTATACGAAGTTAT). (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count