Clec3a^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCTCCTAATCCCTTTGGG and GTAGGCCCCCTCAGTAAACT, which resulted in a 730 bp deletion beginning at Chromosome 8 position 114,425,191 bp and ending after 114,425,920 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000365573 (exon 3) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 23 amino acids later. (J:188991)