Nat14^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAAAGACACGGAAAACCGTG and CATGGGCTATATGCTGGTTA, which resulted in a 510 bp deletion beginning at Chromosome 7 position 4,923,920 bp and ending after 4,924,429 bp (GRCm38/mm10). This mutation deletes 510 bp of ENSMUSE00000494728 (exon 3) and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 5 amino acids later. (J:188991)