Rbm48^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGTACATTTGGGAAACAGT and CTTCTCACAGGGCAAGCCCA, which resulted in a 427 bp deletion beginning at Chromosome 5 position 3,595,181 bp and ending after 3,595,707 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001244523 (exon 2) and 336 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 2 amino acids later. (J:188991)