Hsfy2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AACCATCACTCATCTTCTTG and GGATATGGCTGAAGCACCTT, which resulted in a 1177 bp deletion beginning at Chromosome 1 position 56,636,197 bp and ending after 56,637,373 bp (GRCm38/mm10). This mutation deletes 1177 bp from ENSMUSE00000411336 (exon 1) and is predicted to cause a change of amino acid sequence after residue 2 and truncation 18 amino acids later by read through into the 3-prime UTR. (J:188991)