Specc1l^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGATACTTTTATCATGTCG and TTTGAGGAGATCTTTCAGCA, which resulted in a 408 bp deletion beginning at Chromosome 10 position 75,230,598 bp and ending after 75,231,005 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001237072 (exon 4) and 218 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 7 amino acids later. (J:188991)