This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTCAGGGCATATAAGTCAG and GCCATGTTACAGGATCATAA, which resulted in a 2551 bp deletion beginning at Chromosome 10 position 31,503,602 bp and ending after 31,506,152 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000463122 and ENSMUSE00000464525 (exons 4 and 5) and 2237 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 400 and truncation 55 amino acids later by read through into the 3 UTR. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count