Klhdc10^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGATGGATCTCTCTCACA and ACAAGGCAAGCGCACAGCCG, which resulted in a 365 bp deletion beginning at Chromosome 6 position 30,441,596 bp and ending after 30,441,960 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001221353 (exon 4) and 210 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 155 and early truncation 20 amino acids later. (J:188991)