Armc3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCACATCAAAATTAACAG and GAGAATACCCTGAGTGAAAG, which resulted in a 406 bp deletion beginning at Chromosome 2 position 19,235,420 bp and ending after 19,235,825 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000290542 (exon 3) and 288 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 16 and early truncation 16 amino acids later. There is a 6 bp deletion (CCTTTC) 15 bp downstream the 406 bp deletion. (J:188991)