This allele from project TCPR1319 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes single guide RNAs having spacer sequences of AGCCAGTAAATAATCTCGAA and AGTCTGCGAACTGTGTTGGG and 2 single-strand oligonucleotides to introduce loxP sites. The loxP sites were not incorporated into this allele instead a 815-bp Chr4: 132335167 to 132335981_insGACTCCTG. (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count