Zfp593^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGCAAGCCAGACAGCGATGC and ATGGGTCGCTCTCGGCGGAC, which resulted in a 177 bp deletion beginning at Chromosome 4 position 134,245,317 bp and ending after 134,245,493 bp (GRCm38/mm10). This mutation deletes 177 bp of ENSMUSE00000389670 (exon 1) and is predicted to cause a change of amino acid sequence after residue 3 a loss of 59 amino acids and then return into frame. (J:188991)