Eepd1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACAGGTCCGAGGGATCTCT and GGTGGTGTGCATGACGCTTC, which resulted in a 661 bp deletion beginning at Chromosome 9 position 25,482,477 bp and ending after 25,483,137 bp (GRCm38/mm10). This mutation deletes 661 bp of ENSMUSE00000410963 (exon 2) and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 11 amino acids later. There is a 4 bp deletion (GCTT) 166 bp downstream of the 661 bp deletion. (J:188991)