Slc25a42^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATCGCATCCCTAACCTGC and GGTCAAGGCCTCATAGAGGC, which resulted in a 448 bp deletion beginning at Chromosome 8 position 70,191,590 bp and ending after 70,192,037 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001280784 (exon 3) and 342 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 27 and early truncation 37 amino acids later. (J:188991)