This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTCTGGGTGGGTCTCTTGC and GGTGATACCAAACCTGTTTC, which resulted in a 2259 bp deletion beginning at Chromosome 18 position 37,301,055 bp and ending after 37,303,313 bp (GRCm38/mm10). This mutation deletes 2259 bp of ENSMUSE00000402031 (exon 1) and is predicted to cause a change of amino acid sequence after residue 25 and early truncation 6 amino acids later. (J:188991)