Ccnt1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCCTGGGTAAAAATGTCTGT and AGTTATTTACATCCTTTTGC, which resulted in a 231 bp deletion beginning at Chromosome 15 position 98,554,468 bp and ending after 98,554,698 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001268103 (exon 4) and 170 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 124 and early truncation 3 amino acids later. (J:188991)