Pcdhb9^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGGTGAAGATTCCTCCAAAG and TATGGAAAGTCCCCACTGCA, which resulted in a 2432 bp deletion beginning at Chromosome 18 position 37,400,984 bp and ending after 37,403,415 bp (GRCm38/mm10). This mutation internally deletes 2433 bp from ENSMUSE00000413638 (exon 1) and is predicted to cause a change of amino acid sequence after residue 10, a loss of 813 amino acids, returning into frame 7 amino acids before the termination. There is a 1 bp deletion (C) 3 bp before the 2432 bp deletion. (J:188991)