Homer2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCAAAATGTATCTGCGCTG and TGTATGAGCCTCTTGGTGCA, which resulted in a 621 bp deletion beginning at Chromosome 7 position 81,618,326 bp and ending after 81,618,946 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000153416 (exon 5) and 481 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 129 and early truncation 46 amino acids later. (J:188991)