This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAATGGTTCTGGTTTGCCG and ATAAGACCACCGACAGCTGG, which resulted in a 1170 bp deletion beginning at Chromosome 14 position 55,632,815 bp and ending after 55,634,584 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001294570 through ENSMUSE00001229180 (exons 5-10) and 1043 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 93 and early truncation 17 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count