Tmem67^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATACAGGTAGTCATTAAAG and AGAGTGTCTTCACAGATTGC, which resulted in a 423 bp deletion beginning at Chromosome 4 position 12,077,241 bp and ending after 12,077,663 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001271282 (exon 4) and 323 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 138 and early truncation 9 amino acids later. (J:188991)