This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGTATGATAAGACAAGCAG and GAGTCCACACTGGAGGACAG, which resulted in a 645 bp deletion beginning at Chromosome 7 position 16,076,086 bp and ending after 16,076,730 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000677010 (exon 2) and 404 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 43 amino acids later. There is an additional 2 bp deletion (TT) 98 bp before the 645 bp deletion site. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count