This allele from project TCPR1305 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATTGAGCTATGAGTCTAACA, GTCATTGAATATCACAGCTC, and GTGACCGGGCCTAGAATACC targeting a critical region. This resulted in a 418-bp del Chr1:153891772-153892189_insGGA, 14-bp del Chr1:153892701-153892714 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count