This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGTGTCCCACAACTGGATC and CAGCACCAGCAAGTCACCGC, which resulted in a 428 bp deletion beginning at Chromosome 3 position 51,493,354 bp and ending after 51,493,781 bp (GRCm38/mm10). This mutation deletes 426 bp of the coding sequence (leaving the last 15 bases) of ENSMUSE00000387710 (exon 2) including the splice acceptor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 54 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count