This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAACCACAGATTAGATCA and CATGCATCAATATAGAGTAC, which resulted in a 321 bp deletion beginning at Chromosome 14 position 56,912,866 bp and ending after 56,913,186 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000309143 (exon 4) and 155 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 377 and early truncation 9 amino acids later. There is an 8 bp insertion (GCATGATT) at the deletion site. (J:188991)
Basic Information
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count