This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAGCTTACCAATAGCCAGC and TGAGAAGTCTGCTTCACATG, which resulted in a 378 bp deletion beginning at Chromosome 2 position 31,674,483 bp and ending after 31,674,860 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001310800 and ENSMUSE00001254592 (exons 3 and 4) and 242 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 10 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count