Dennd2b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCACCGGAAGTCACAGAAC and GGGTAGATGGGACTTCTTGG, which resulted in a 1217 bp deletion beginning at Chromosome 7 position 109,556,205 bp and ending after 109,557,421 bp (GRCm38/mm10). This mutation deletes 1211 bp of ENSMUSE00000384284 (exon 3) after the first 40 bp and 6 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 36 amino acids later. (J:188991)