Fyttd1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTTTCCTTTTTAACTAAGG and AGCGTATTTTGATAGATGTA, which resulted in a 471 bp deletion beginning at Chromosome 16 position 32,891,201 bp and ending after 32,891,671 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001268836 (exon 3) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 19 amino acids later. (J:188991)