Polr3b^em5Tcp

This allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with a single guide RNA with the spacer sequence TCATGTCCCTCAGACGGCAC resulting in two SNV changes C>T at Chr10:84632451 to disrupt PAM (within intron) and G>A at Chr10:84632459 which is predicted to result in a p.R103H change (GRCm38). (J:200814)