This allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with a single guide RNA with the spacer sequence TCATGTCCCTCAGACGGCAC resulting in a 5-bp deletion on Chr10 from 84632454 to 84632458_delGTGCC (GRCm38). (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count