This allele from project TCPR0319 was generated at The Centre for Phenogenomics by injecting Cas9 D10A endonuclease (nickase) mRNA and four guide RNAs with spacer sequences of TCCACATTTTGCTCGGCTCA and CTGCGTTTTACCTTCCCCAA targeting the 5' side and GTACAGATTCATGGGCCCAC and GCAGGCGGGTGTGAAGCATC targeting the 3' side of exon ENMUSE00000514786 resulting in a 571 bp deletion of Chr18 from 77847863 to 77848434 and a 21 bp del of Chr18 from 77848578 to 77848599 with insGA (GRCm38). (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count