This allele from project TCPR0236 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein with a single guide RNA with spacer sequence GGATCGGGTCTGTCCCGTTG along with a single-strand oligonucleotide repair template. Homology-directed repair resulted in c.1476C>T, a silent coding change disrupting the PAM sequence, and c.1483G>C that is predicted to cause p.G495R. These changes are at Chromosome 15 positive strand 95948358 bp and 95948365 bp (GRCm38), respectively. (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count