Bltp3b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGTGAGTCTACAGTTTGG and ACTCGGCTTCAATAGATACT, which resulted in a 641 bp deletion beginning at Chromosome 10 position 89,772,175 bp and ending after 89,772,815 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000574231 (exon 4) and 549 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 82. (J:188991)