This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATACGGTGGGGCCATGCCG and TCAACATCGGAACATTTGCA, which resulted in a 1760 bp deletion beginning at Chromosome 12 position 112,503,090 bp and ending after 112,504,849 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000435049, ENSMUSE00000435046 (exons 2,3) and 1543 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 18 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count