This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTCACCTTCACTTTCTAA and TTAGTAACTTTGAGCAAAAT, which resulted in a 2527 bp deletion beginning at Chromosome 12 position 56,339,932 bp and ending after 56,342,458 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314161 through ENSMUSE00000114025 (exons 2 through 4) and 2091 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 20 amino acids later. There is a 1 bp insertion (G) at the deletion site. (J:188991)
Basic Information
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count