This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTATGTCTCTCTAGACAGA and CCCGCCTTACAGAAAATGGA, which resulted in a 2807 bp deletion beginning at Chromosome 18 position 24,111,655 bp and ending after 24,114,461 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001222154, ENSMUSE00000365673 (exon 2-4) and 2516 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 51 a deletion of 97 amino acids and then returns in frame for an additional 43 amino acid. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count