Banp^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCTTTACTGTATAAATATT and TTACTGATCTGCCCTCGCCC, which resulted in a 549 bp deletion beginning at Chromosome 8 position 121,978,299 bp and ending after 121,978,847 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000605765 (exon 4) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 11 amino acids later. (J:188991)