Mphosph8^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAATAGTCTTGGTGGCGGG and TGTGTATTATGTGTACACCA, which resulted in a 319 bp deletion beginning at Chromosome 14 position 56,676,388 bp and ending after 56,676,706 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000309555 (exon 4) and 222 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 406 and early truncation 38 amino acids later. (J:188991)