Spag6^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGGTTAGTTACTAACCAG and AGGGAATCTGAAGGAGACGG, which resulted in a 533 bp deletion beginning at Chromosome 2 position 18,715,493 bp and ending after 18,716,025 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000605260 (exon 4) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 96 and early truncation 14 amino acids later. (J:188991)