Exosc1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTATGGATGTCACATACCA and GGACTTTAGCTCAGATTGAA, which resulted in a 3625 bp deletion beginning at Chromosome 19 position 41,924,589 bp and ending after 41,928,213 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000278630, ENSMUSE00000278546 (exons 4-7) and 3366 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 64 amino acids later. (J:188991)