Efhb^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGTGATGTCATTGTCAAC and ATACATTCCACTCCTTAACC, which resulted in a 3470 bp deletion beginning at Chromosome 17 position 53,449,206 bp and ending after 53,452,675 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000136456 through ENSMUSE00000136452 (exon 2-4) and 3082 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 283 and early truncation 7 amino acids later. (J:188991)