A C-to-G mutation was engineered in proline codon 522 (CCC) to change it to an arginine codon (CGC) (c.1565C>G, p.P522R) with an sgRNA (targeting CCAAAATGCAGCTCCGTGGG) and an ssODN template (GAGCTGTAATAAGCCCTTTCGGATGCTTGTGGCTCAGGACACTCGCCCCACGGAGCTGCATTTTGGGGAGAAATGGTTCCACA) using CRISPR/Cas9 technology. The mutation models a human SNP that was identified in a whole exome chip of rare SNPs associated with Alzheimer's disease and has been associated with protection from Alzheimer's disease. (J:308279)
Basic Information
B6(SJL)-Apoetm1.1(APOE*4)Adiuj/J
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count