This allele from project TCPC309 was generated at The Centre for Phenogenomics by injecting Cas9D10A mRNA and guide RNAs with spacer sequences GGTCCCGGTGAAGCACAGTG and CAGCAAACACAATGTCAAGC, which resulted in an 8-bp deletion CTTCACCG in Chromosome 1 positive strand 191822588 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. c.412_419delCTTCACCG; p.(L138Gfs*22) (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count