This allele from project TCPR0565 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and a single guide RNA with a spacer sequence of ATTTCAGCGGGGTCGGTTCC along with a lacZ target vector. The lacZ was not incorporated into the allele and instead non-homologous end-joining repair resulted in an indel at ChrX:151294546-151294547_delGT (GRCm38). (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count