This allele from project TCPR1166 was generated at The Centre for Phenogenomics by electroporation of Cpf1 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTATTCTCGTGTTATTCCTT targeting the 5' side and CCTGGAGAATACTGTTTACTT targeting the 3' side leading to the deletion of 257-bp on Chr8 from 40528311 to 40528567 (GRCm38) deleting a critical exon and resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count