This allele from project TCPR0854 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four single guide RNAs with spacer sequences of AAGTCTATGTTCAGTGGGGT and TGGTCAGTGGGCTACTGGCT targeting the 5' side and AATGGACCATAGTGTCCAGC and GGTATGAAGTACCTGGCCTC targeting the 3' side of a critical exon. This resulted in a 364-bp del Chr7:96694732 to 96695095; 250-bp del Chr7:96695161 to 96695410 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count